Home | Projects | Login or register:
Username:   Password:

Worm gene name:  egl-4
Worm sequence name:  F55A8.2a.1
Related human gene:  PRKG1
Associated human disease: 
People involved in this project: 
Left primer sequence:  cgtgtgctcaatcaaggaga
Right primer sequence:  ggcggtgtaatcgtcaaagt
Size of PCR product:  573
Brief description:  I am interested in the regulatory pathways affect global organism size. egl-4 deletion or inhibition results in worms that are much larger in size, and live 50% longer compared to the wild-type N2 worms. "egl-4 encodes a cyclic GMP-dependent protein kinase that may act through the TGF-beta signaling pathway to relay sensory cues that modulate chemosensory behavior, dauer formation, foraging, egg laying, body size, and endoreduplication in response to dietary restriction; egl-4 is also required for lethargus, a sleep-like state that is induced before each of the four larval molts; in addition, genetic studies indicate that egl-4 may also act through daf-16 to regulate adult lifespan; an egl-4::gfp promoter fusion is expressed in body wall muscle, head neurons, hypodermis, and the intestine."-(Wormbase)
Report any problems that might have appeared and any solutions: 
View(0) or add comments