| Worm gene name: | egl-4 |
| Worm sequence name: | F55A8.2a.1 |
| Related human gene: | PRKG1 |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | cgtgtgctcaatcaaggaga |
| Right primer sequence: | ggcggtgtaatcgtcaaagt |
| Size of PCR product: | 573 |
| Brief description: | I am interested in the regulatory pathways affect global organism size. egl-4 deletion or inhibition results in worms that are much larger in size, and live 50% longer compared to the wild-type N2 worms. "egl-4 encodes a cyclic GMP-dependent protein kinase that may act through the TGF-beta signaling pathway to relay sensory cues that modulate chemosensory behavior, dauer formation, foraging, egg laying, body size, and endoreduplication in response to dietary restriction; egl-4 is also required for lethargus, a sleep-like state that is induced before each of the four larval molts; in addition, genetic studies indicate that egl-4 may also act through daf-16 to regulate adult lifespan; an egl-4::gfp promoter fusion is expressed in body wall muscle, head neurons, hypodermis, and the intestine."-(Wormbase) |
| Report any problems that might have appeared and any solutions: | |
