| Worm gene name: | nmr-2 |
| Worm sequence name: | T01C3.10 |
| Related human gene: | GRIN2D |
| Associated human disease: | learning and memory?; locomotory behavior; sensory perception of pain |
| People involved in this project: |
|
| Left primer sequence: | tcgattgatttgggaggaag |
| Right primer sequence: | tttggcgggaatttttgtag |
| Size of PCR product: | 316 |
| Brief description: | This is 2nd of 5 probes found on E-RNAi; chose this one because it had highest percent efficiency and lowest GC content |
| Report any problems that might have appeared and any solutions: | |
