Home | Projects | Login or register:
Username:   Password:

Worm gene name:  nmr-2
Worm sequence name:  T01C3.10
Related human gene:  GRIN2D
Associated human disease:  learning and memory?; locomotory behavior; sensory perception of pain
People involved in this project: 
Left primer sequence:  tcgattgatttgggaggaag
Right primer sequence:  tttggcgggaatttttgtag
Size of PCR product:  316
Brief description:  This is 2nd of 5 probes found on E-RNAi; chose this one because it had highest percent efficiency and lowest GC content
Report any problems that might have appeared and any solutions: 
View(0) or add comments