Worm gene name: | cua-1 |
Worm sequence name: | Y76A2A.2 |
Related human gene: | ATP7A |
Associated human disease: | Menkes disease |
People involved in this project: |
|
Left primer sequence: | gcgaatcgaatagaatccca |
Right primer sequence: | aaaaatctgaaccggtgtgc |
Size of PCR product: | 393 |
Brief description: | My best friend had to have a liver transplant due to a copper transport disease (Wilsons disease) and this gene was closely related in C. elegans |
Report any problems that might have appeared and any solutions: | |