Home | Projects | Login or register:
Username:   Password:

Worm gene name:  cua-1
Worm sequence name:  Y76A2A.2
Related human gene:  ATP7A
Associated human disease:  Menkes disease
People involved in this project: 
Left primer sequence:  gcgaatcgaatagaatccca
Right primer sequence:  aaaaatctgaaccggtgtgc
Size of PCR product:  393
Brief description:  My best friend had to have a liver transplant due to a copper transport disease (Wilsons disease) and this gene was closely related in C. elegans
Report any problems that might have appeared and any solutions: 
View(0) or add comments