| Worm gene name: | let-60 |
| Worm sequence name: | ZK792.6 |
| Related human gene: | LOCUS AK292510 1418 bp |
| Associated human disease: | highly similar to Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) |
| People involved in this project: |
|
| Left primer sequence: | gagacatgcctcctcgacat |
| Right primer sequence: | cagaccgggtgtcgtatttt |
| Size of PCR product: | 547 |
| Brief description: | De novo designed RNAi primer using e-RNAi.
This project deals with Pancreatic Acinar Carcinoma (OMIM 260350) Point mutations in codon 12 of the KRAS2 gene (190070) occur in 75 to 95% of pancreatic cancers, and also occur in foci of pancreatic intraepithelial neoplasia, a putative precursor lesion of pancreatic cancer. The human cDNA with highest score is highly similar to Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog. The C. elegans WBGene00002335 locus let-60 was found to have high sequence alignment score to the human cDNA sequence. Other worm genes that had gigh alignment score were RAS and RAP proteins. The C. elegans gene let-60 encodes a member of the GTP-binding RAS protooncogene family; let-60 activity is required for viability, vulval development, spicule development, germ line meiotic progression, posterior development of the hypodermis, chemotaxis, sex myoblast migration, and muscle membrane extension; let-60 acts genetically downstream of let-23 with respect to vulval development and upstream of the MAPK pathway with respect to chemotaxis; let-60 is expressed in neural, muscle, and hypodermal lineages (WormBase description). |
| Report any problems that might have appeared and any solutions: | |
