| Worm gene name: | egl-15 |
| Worm sequence name: | F58A3.2 |
| Related human gene: | FGFR-1 |
| Associated human disease: | Pfeiffer Syndrome |
| People involved in this project: |
|
| Left primer sequence: | ccgtgcatgactctgaagaa |
| Right primer sequence: | ctggtagagcatgcgtttca |
| Size of PCR product: | 503 |
| Brief description: | Fibroblast growth factor receptor 1 (FGFR-1) is a tyrosine kinase regulating cell division. In some families, a mutation in FGFR-1 results in Pfeiffer Syndrome, with a phenotype of broad, short thumbs and big toes. The proximal phalanx of the thumb was either triangular or trapezoid (and occasionally fused with the distal phalanx) so that the thumb pointed outward. Different families have shown various methods of inheritance (autosomal dominant, Y-linked dominant). |
| Report any problems that might have appeared and any solutions: | |
