Home | Projects | Login or register:
Username:   Password:

Worm gene name:  F53F4.10 (Hypothetical protein)
Worm sequence name:  F53F4.10
Related human gene:  NADH-Ubiquinone Oxidoreductase Flavoprotein 2; NDUFV2
Associated human disease:  Susceptibility gene to Parkinson disease (PD)
People involved in this project: 
Left primer sequence:  tgaaatggtgatcaagcgag
Right primer sequence:  gaagcatgcatggggtagtt
Size of PCR product:  350
Brief description:  Within the CNS, mitochondrial complex I deficiency appears to be confined to the substantia nigra. Evidence implicates the 24-kD subunit of mitochondrial complex I in the pathogenesis of Parkinson disease. In a study by Hattori et al. (1998), the risk of developing PD associated with homozygosity for this mutation was calculated as 2.40.
Report any problems that might have appeared and any solutions:  This is a hypothetical protein in C. elegans, but it has all of the similarities that would suggest this is the human homologue mentioned in the above reference.
Media attachments: 
  • F534f.10  F534f.10
     
View(0) or add comments