| Worm gene name: | F53F4.10 (Hypothetical protein) |
| Worm sequence name: | F53F4.10 |
| Related human gene: | NADH-Ubiquinone Oxidoreductase Flavoprotein 2; NDUFV2 |
| Associated human disease: | Susceptibility gene to Parkinson disease (PD) |
| People involved in this project: |
|
| Left primer sequence: | tgaaatggtgatcaagcgag |
| Right primer sequence: | gaagcatgcatggggtagtt |
| Size of PCR product: | 350 |
| Brief description: | Within the CNS, mitochondrial complex I deficiency appears to be confined to the substantia nigra. Evidence implicates the 24-kD subunit of mitochondrial complex I in the pathogenesis of Parkinson disease. In a study by Hattori et al. (1998), the risk of developing PD associated with homozygosity for this mutation was calculated as 2.40. |
| Report any problems that might have appeared and any solutions: | This is a hypothetical protein in C. elegans, but it has all of the similarities that would suggest this is the human homologue mentioned in the above reference. |
| Media attachments: |
|
