Worm gene name: |
Tyramine Beta Hydroxylase family member tbh-1
|
Worm sequence name: |
Gene ID number: 181639 for tbh-1
|
Related human gene: |
Dopamine beta-hydroxylase
|
Associated human disease: |
allele variations include inability to produce noradrenaline and adrenaline;resistance to Parkinson's; and tobacco addiction;
|
People involved in this project: |
|
Left primer sequence: |
gaacgccagttggttgattt
|
Right primer sequence: |
agtggttcctggcaaaaatg
|
Size of PCR product: |
281
|
Brief description: |
catalyzes the oxidative hydroxylation of dopamine to norepinephrine
|
Report any problems that might have appeared and any solutions: |
|