| Worm gene name: | Tyramine Beta Hydroxylase family member tbh-1 |
| Worm sequence name: | Gene ID number: 181639 for tbh-1 |
| Related human gene: | Dopamine beta-hydroxylase |
| Associated human disease: | allele variations include inability to produce noradrenaline and adrenaline;resistance to Parkinson's; and tobacco addiction; |
| People involved in this project: |
|
| Left primer sequence: | gaacgccagttggttgattt |
| Right primer sequence: | agtggttcctggcaaaaatg |
| Size of PCR product: | 281 |
| Brief description: | catalyzes the oxidative hydroxylation of dopamine to norepinephrine |
| Report any problems that might have appeared and any solutions: | |
