Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Tyramine Beta Hydroxylase family member tbh-1
Worm sequence name:  Gene ID number: 181639 for tbh-1
Related human gene:  Dopamine beta-hydroxylase
Associated human disease:  allele variations include inability to produce noradrenaline and adrenaline;resistance to Parkinson's; and tobacco addiction;
People involved in this project: 
Left primer sequence:  gaacgccagttggttgattt
Right primer sequence:  agtggttcctggcaaaaatg
Size of PCR product:  281
Brief description:  catalyzes the oxidative hydroxylation of dopamine to norepinephrine
Report any problems that might have appeared and any solutions: 
View(0) or add comments