| Worm gene name: | PVF-1 |
| Worm sequence name: | Y39A3CL.6 |
| Related human gene: | platelet-derived growth factor alpha isoform 2 preproprotein [Ho |
| Associated human disease: | Systemic Scleroderma |
| People involved in this project: |
|
| Left primer sequence: | ttcccgtgtttttgatgaca |
| Right primer sequence: | tcccctcttcacatttcagg |
| Size of PCR product: | 469 |
| Brief description: | In a study of chemokine expression in fibroblasts from patients with systemic sclerosis and controls, Galindo et al. (2001) found that systemic sclerosis fibroblasts displayed increased constitutive expression of monocyte chemotactic protein-1 (MCP1; 158105) mRNA and protein and showed a blunted response to oxidative stress. In systemic sclerosis skin sections, expression of MCP1 was detected in fibroblasts, keratinocytes, and mononuclear cells, whereas it was undetectable in normal skin. Stimulation with platelet-derived growth factor (PDGF; see 173430) resulted in increased MCP1 mRNA and protein. |
| Report any problems that might have appeared and any solutions: | Five primers were generated each with efficiencies and specificity <50%. The best primer was chosen from this list. |
