Home | Projects | Login or register:
Username:   Password:

Worm gene name:  skn-1
Worm sequence name:  T19E7.2
Related human gene:  Nrf2
Associated human disease:  Thought to be a new treatment target for PD and other diseases related to increased oxidative stress
People involved in this project: 
Left primer sequence:  gagaaatcgacagtagcgcc
Right primer sequence:  catctcttgcatctcggtca
Size of PCR product:  36
Brief description:  NRF2 has a hydrophilic N-terminal domain, followed by an acidic region with characteristics of a DNA activation domain, a central cnc homology region conserved among NFE2 family members, a basic DNA-binding domain, and a C-terminal leucine zipper dimerization domain that contains charged residues predicted to impede homodimer formation. Data from mammals generated by various groups indicate that Nrf2 induces the expression of a group of cytoprotective, antixenobiotic and antioxidant enzymes that include heme oxygenase-1, NAD(P)H:quinone oxidoreductase and enzymes of glutathione (GSH) metabolism such as γ-glutamyl cysteine ligase and various GSH transferases.
Report any problems that might have appeared and any solutions:  BLAST results indicate limited homology to human genes, but the entire sequence protein sequence is only 582 amino acids. eRNAi search results produced 5 potential probes for this gene. Only the best one (50% specificity, 45% efficiency and primer3 ranking of 2) is reported here.
Media attachments: 
  • skn-1 gene summary  skn-1 gene summary
     
View(0) or add comments