Worm gene name: |
skn-1
|
Worm sequence name: |
T19E7.2
|
Related human gene: |
Nrf2
|
Associated human disease: |
Thought to be a new treatment target for PD and other diseases related to increased oxidative stress
|
People involved in this project: |
|
Left primer sequence: |
gagaaatcgacagtagcgcc
|
Right primer sequence: |
catctcttgcatctcggtca
|
Size of PCR product: |
36
|
Brief description: |
NRF2 has a hydrophilic N-terminal domain, followed by an acidic region with characteristics of a DNA activation domain, a central cnc homology region conserved among NFE2 family members, a basic DNA-binding domain, and a C-terminal leucine zipper dimerization domain that contains charged residues predicted to impede homodimer formation. Data from mammals generated by various groups indicate that Nrf2 induces the expression of a group of cytoprotective, antixenobiotic and antioxidant enzymes that include heme oxygenase-1, NAD(P)H:quinone oxidoreductase and enzymes of glutathione (GSH) metabolism such as γ-glutamyl cysteine ligase and various GSH transferases.
|
Report any problems that might have appeared and any solutions: |
BLAST results indicate limited homology to human genes, but the entire sequence protein sequence is only 582 amino acids. eRNAi search results produced 5 potential probes for this gene. Only the best one (50% specificity, 45% efficiency and primer3 ranking of 2) is reported here.
|
Media attachments: |
|