Home | Projects | Login or register:
Username:   Password:

Worm gene name:  rnf-113
Worm sequence name:  RiNg Finger protein family member
Related human gene:  Breast cancer 1 gene early onset isoform 5
Associated human disease:  Breast cancer
People involved in this project: 
Left primer sequence:  cgagtccaacagcaactgaa
Right primer sequence:  cctgttcctcatcgctcttc
Size of PCR product:  727
Brief description:  Human breast cancer 1 gene early onset isoform 5 blasted against C elegans database. RiNg finger protein family member was homologous based on a blast.
Report any problems that might have appeared and any solutions: 
View(0) or add comments