Home | Projects | Login or register:
Username:   Password:

Worm gene name:  mrp-1
Worm sequence name:  F57C12.5
Related human gene:  CF Transmembrane Conductance Regulator: ABC superfamily protien
Associated human disease:  Cystic Fibrosis
People involved in this project: 
Left primer sequence:  tggtgcgtattatgcgttgt
Right primer sequence:  ggaagtaaacagcagctccg
Size of PCR product:  483
Brief description:  mrp-1 encodes an ATP-binding cassette (ABC) transporter most closely related to the multidrug resistance-associated proteins; mrp-1 activity is required for efficient RNA interference (RNAi) of a germline-expressed target, pop-1
Report any problems that might have appeared and any solutions: 
View(0) or add comments