| Worm gene name: | mrp-1 |
| Worm sequence name: | F57C12.5 |
| Related human gene: | CF Transmembrane Conductance Regulator: ABC superfamily protien |
| Associated human disease: | Cystic Fibrosis |
| People involved in this project: |
|
| Left primer sequence: | tggtgcgtattatgcgttgt |
| Right primer sequence: | ggaagtaaacagcagctccg |
| Size of PCR product: | 483 |
| Brief description: | mrp-1 encodes an ATP-binding cassette (ABC) transporter most closely related to the multidrug resistance-associated proteins; mrp-1 activity is required for efficient RNA interference (RNAi) of a germline-expressed target, pop-1 |
| Report any problems that might have appeared and any solutions: | |
