Worm gene name:  ver-4
Worm sequence name:  F59F3.5
Related human gene:  VEGF
Associated human disease:  susceptibility to atherosclerosis
People involved in this project: 
Left primer sequence:  tgaagccaaattcgacagtg
Right primer sequence:  gcttctgttcctccaagtgc
Size of PCR product:  524
Brief description:  In humans, VEGF is a protein crucial to endothelial cell growth. When mutated, endothelial cells do not replicate sufficiently to keep blood vessels supple. Suppressing VEGF in tumor masses is useful for shrinking tumors by limiting formation of new blood vessels. In worms, a mutation in ver-4 results in the following phenotypes: sluggish, slow growth, and abnormal protein aggregation.
Report any problems that might have appeared and any solutions: 
Media attachments: 
  • ver-4 gene structure  ver-4 gene structure
     worm base