Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dop-4
Worm sequence name:  C52B11.3
Related human gene:  DRD4
Associated human disease:  ADHD
People involved in this project: 
Left primer sequence:  actttccattgtggtcggag
Right primer sequence:  caattgaagtattcggcggt
Size of PCR product:  323
Brief description:  A mutation in this gene produces a defective dopamine D2-like receptor that inhibits adenylyl cyclase. Human mutations are associated with attention deficit hyperactivity disorder, Parkinson’s disease, alcoholism and mood disorders.
Worm mutations in this gene produce uncoordinated movement & abnormal egg laying.
Report any problems that might have appeared and any solutions: 
View(0) or add comments