| Worm gene name: | dop-4 |
| Worm sequence name: | C52B11.3 |
| Related human gene: | DRD4 |
| Associated human disease: | ADHD |
| People involved in this project: |
|
| Left primer sequence: | actttccattgtggtcggag |
| Right primer sequence: | caattgaagtattcggcggt |
| Size of PCR product: | 323 |
| Brief description: | A mutation in this gene produces a defective dopamine D2-like receptor that inhibits adenylyl cyclase. Human mutations are associated with attention deficit hyperactivity disorder, Parkinson’s disease, alcoholism and mood disorders.
Worm mutations in this gene produce uncoordinated movement & abnormal egg laying. |
| Report any problems that might have appeared and any solutions: | |
