| Worm gene name: | unc-2 |
| Worm sequence name: | T02C5.5 |
| Related human gene: | CACNA1A |
| Associated human disease: | ataxia, migraine headache, epilepsy |
| People involved in this project: |
|
| Left primer sequence: | actgtgtggtcatcgttgga |
| Right primer sequence: | tcctgagcgttggctaagtt |
| Size of PCR product: | 547 |
| Brief description: | Mutations in this gene produce a defective alpha 1A subunit of the voltage-dependent calcium channel. Human mutations affect the nervous system producing several forms of ataxia or uncoordinated movement, migraine headaches and epilepsy.
Worm mutations in this gene also produce uncoordinated movement including irregular or reduced pharyngeal pumping, abnormal locomotion, hyperactive egg laying, and abnormal defecation. Another phenotype observed is aldicarb resistance. |
| Report any problems that might have appeared and any solutions: | |
