| Worm gene name: | daf-7 |
| Worm sequence name: | B0412.2 |
| Related human gene: | TGFB-1 |
| Associated human disease: | Tumor/keloid |
| People involved in this project: |
|
| Left primer sequence: | caatgtcaacggaatgatcg |
| Right primer sequence: | acaactacgcacgcacagac |
| Size of PCR product: | 439 |
| Brief description: | This human gene has been shown to be associated with the production of keloid. I would like to see the phenotype in worms when this gene is knocked out. |
| Report any problems that might have appeared and any solutions: | |
