Worm gene name: | daf-7 |
Worm sequence name: | B0412.2 |
Related human gene: | TGFB-1 |
Associated human disease: | Tumor/keloid |
People involved in this project: |
|
Left primer sequence: | caatgtcaacggaatgatcg |
Right primer sequence: | acaactacgcacgcacagac |
Size of PCR product: | 439 |
Brief description: | This human gene has been shown to be associated with the production of keloid. I would like to see the phenotype in worms when this gene is knocked out. |
Report any problems that might have appeared and any solutions: | |