Home | Projects | Login or register:
Username:   Password:

Worm gene name:  daf-7
Worm sequence name:  B0412.2
Related human gene:  TGFB-1
Associated human disease:  Tumor/keloid
People involved in this project: 
Left primer sequence:  caatgtcaacggaatgatcg
Right primer sequence:  acaactacgcacgcacagac
Size of PCR product:  439
Brief description:  This human gene has been shown to be associated with the production of keloid. I would like to see the phenotype in worms when this gene is knocked out.
Report any problems that might have appeared and any solutions: 
View(0) or add comments