| Worm gene name: | F13B12.5 |
| Worm sequence name: | F13B12.5 |
| Related human gene: | Insulin |
| Associated human disease: | Type I Diabetes |
| People involved in this project: |
|
| Left primer sequence: | cgcgatctttttcacattca |
| Right primer sequence: | gagaaagattggaaacggca |
| Size of PCR product: | 315 |
| Brief description: | Insulin is required to bind to a cell surface receptor before glucose can enter the cells. Impaired or lack of insulin production results in type I diabetes. This animal model will look at phenotype effects on the worms by silencing the homolog for insulin. If phenotype effects are seen, this model can be used to study effects of alternative medicines for providing insulin activity. One such alternative medicine candidate is ginseng which has been shown to lower blood glucose levels. The mechanism of action is still not completely understood. |
| Report any problems that might have appeared and any solutions: | |
