Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Sod-1
Worm sequence name:  C115F1.7a
Related human gene:  Sod-1
Associated human disease:  Amyotrophic Lateral Sclerosis
People involved in this project: 
Left primer sequence:  tggatcacacagaagtccga
Right primer sequence:  acaaccatagatcggccaac
Size of PCR product:  302
Brief description:  A mutation in the S0D-1 in humans is associated with ALS. The mutation in the gene in the C. elegans worm is associated with a phenotypic expression demonstrating slow-growth. Using RNAi I would like to demonstrate the phenotypic changes using the primer from the eRNAi website.
Report any problems that might have appeared and any solutions:  In WormBase a similar experiment has been done with different primers.
View(0) or add comments