| Worm gene name: | APC-1 |
| Worm sequence name: | K04G2.8 |
| Related human gene: | APC |
| Associated human disease: | Colorectal cancer |
| People involved in this project: |
|
| Left primer sequence: | tcttcctgcgtcaaactgtg |
| Right primer sequence: | cagcaagattccacaaagca |
| Size of PCR product: | 539 |
| Brief description: | Many colorectal cancers are caused by the autosomal dominant gene, adenomatous polyposis coli. This gene interferes with the Wnt signaling pathway in humans and C. elegans. The gene product is also invovlved with other pathways as cell migration and adhesion. |
| Report any problems that might have appeared and any solutions: | |
