| Worm gene name: | CCO-1 |
| Worm sequence name: | F26E4.9 |
| Related human gene: | COX5B |
| Associated human disease: | Possible assoication with Diabetes |
| People involved in this project: |
|
| Left primer sequence: | ggctcaacttgctaagacgg |
| Right primer sequence: | ctctttggatctcctttgcg |
| Size of PCR product: | 342 |
| Brief description: | COX is involved in the electron transport chain and is associated with multiple human diseases. |
| Report any problems that might have appeared and any solutions: | |
