Home | Projects | Login or register:
Username:   Password:

Worm gene name:  CCO-1
Worm sequence name:  F26E4.9
Related human gene:  COX5B
Associated human disease:  Possible assoication with Diabetes
People involved in this project: 
Left primer sequence:  ggctcaacttgctaagacgg
Right primer sequence:  ctctttggatctcctttgcg
Size of PCR product:  342
Brief description:  COX is involved in the electron transport chain and is associated with multiple human diseases.
Report any problems that might have appeared and any solutions: 
View(0) or add comments