| Worm gene name: | ftn-2 |
| Worm sequence name: | D1037.3 |
| Related human gene: | FTH1 |
| Associated human disease: | Hemochromatosis |
| People involved in this project: |
|
| Left primer sequence: | gtattgcagccttaccagcc |
| Right primer sequence: | cagaagcgactcgttgttga |
| Size of PCR product: | 418 |
| Brief description: | Hemochromatosis is called “iron overload disease” and is a highly underdiagnosed condition in that damage occurs years before any symptoms are noticed. There are at least 5 variants as identified by clinical, biochemical, and genetic characteristics. The clinical symptoms are diabetes, hypermelanotic pigmentation of the skin (a bronzish appearance), and heart failure. In homozygous individuals who are untreated, nearly one-third will develop cirrhosis of the liver which progresses to liver cancer. With treatment, the cancer can be avoided.
The phenotype in worms is not real distinct. There is abnormal drug response and slow growth. |
| Report any problems that might have appeared and any solutions: | |
