| Worm gene name: | lin-1 |
| Worm sequence name: | C37F5.1 |
| Related human gene: | ETS transcription factor |
| Associated human disease: | cancer, development |
| People involved in this project: |
|
| Left primer sequence: | tgaacgtctcagacttgatgtgta |
| Right primer sequence: | aactacataatactcccgtcccaa |
| Size of PCR product: | 315 |
| Brief description: | Lin-1 encodes a member of the highly conserved ETS transcription factor family. In C.elegans, LIN-1 is a negative regulator of vulval development, which is regulated by the Ras signaling pathway. Our goal was to create a more effective RNAi construct that would knock down lin-1 gene expression in both mutant rrf-3 as well as wild-type N2 worm strains. We targeted the 3' end of the gene to avoid the large intron included in the construct generated by Kamath et al., 2003. While we were able to to increase the specificity of our construct, we did not increase the predicted efficiency. In our RNAi feeding experiments, we were unable to detect multivulva phenotypes using either our construct or the HT115(DE3)/pL4440(lin-1) construct obtained from CSHL, although our positive control dpy-13 RNAi construct worked. |
| Report any problems that might have appeared and any solutions: | By adding attB sites to our primers, we were able to TA clone the lin-1 gDNA into both pL4440 as well as into pPR244 using Clonase BP recombinase (although we have yet to confirm our recombinase colony PCR results with plasmid mapping and sequencing. The cells grow very slowly and plasmid yield is low). The final size of our PCR product was 365 bp, which includes the attB sites flanking the lin-1 sequence. |
