| Worm gene name: | rnt-1 |
| Worm sequence name: | B0414.2 |
| Related human gene: | RUNX1 |
| Associated human disease: | Acute Myeloid Leukemia |
| People involved in this project: |
|
| Left primer sequence: | tattatccgaacgcctggac |
| Right primer sequence: | cgaggagaagatggtcgttt |
| Size of PCR product: | 1011 |
| Brief description: | The protein encoded by the human gene represents the alpha subunit of Core Binding Factor (CBF) and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Mutations in RUNX1 can cause autosomal dominant familial platelet disorder associated with development of acute myelogenous leukemia. To study this platelet disorder in a model organism, I searched for related genes in C. elegans by using BLAST and found that rnt-1 was the most closely related gene to RUNX1 in worms. I then designed primers to amplify the gene and transform into an RNAi feeding strain of E. coli. At this time no tests have been done looking at what happens when the worms ingest the RNAi with rnt-1. |
| Report any problems that might have appeared and any solutions: | |
A follow-up experiment feeding the rnt-1 RNAi feeding vector gave worms that twitch! This needs to be confirmed. B. Nash