Home | Projects | Login or register:
Username:   Password:

Worm gene name:  R02F2.8
Worm sequence name:  hypothetical protein mRNA, cds
Related human gene:  AUX1 (Arabidopsis thaliana)
Associated human disease: 
People involved in this project: 
Left primer sequence:  accattggcaggaaaatgag
Right primer sequence:  cgcgggtttcttcatatcat
Size of PCR product:  423
Brief description:  plant gene on chromosome 2
amino acid transmembrane transporter
Report any problems that might have appeared and any solutions: 
View(0) or add comments