| Worm gene name: | R02F2.8 |
| Worm sequence name: | hypothetical protein mRNA, cds |
| Related human gene: | AUX1 (Arabidopsis thaliana) |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | accattggcaggaaaatgag |
| Right primer sequence: | cgcgggtttcttcatatcat |
| Size of PCR product: | 423 |
| Brief description: | plant gene on chromosome 2
amino acid transmembrane transporter |
| Report any problems that might have appeared and any solutions: | |
