| Worm gene name: | Ceh-10 |
| Worm sequence name: | W03A3.1 |
| Related human gene: | vsx1 |
| Associated human disease: | craniofacial abnormalities |
| People involved in this project: |
|
| Left primer sequence: | gatcgacgaactcgagaagg |
| Right primer sequence: | ctgatgttggggagcttgtt |
| Size of PCR product: | 463 |
| Brief description: | This is a homeobox gene important for development of head and retina. |
| Report any problems that might have appeared and any solutions: | |
