Home | Projects | Login or register:
Username:   Password:

Worm gene name:  rskn-1
Worm sequence name:  T01H8.1
Related human gene:  RPS6KA3
Associated human disease:  Mental retardation, X-linked 19
People involved in this project: 
Left primer sequence:  ctcgatgccacacttcttga
Right primer sequence:  cacttgtgaaccaccgaatg
Size of PCR product:  450
Brief description:  rskn-1 is a member of a multigene family that includes growth factor-regulated serine/threonine kinases. The human homologue RPS6KA3 is involved in developmental processes including regulation of synapsis.
Report any problems that might have appeared and any solutions: 
View(0) or add comments