| Worm gene name: | rskn-1 |
| Worm sequence name: | T01H8.1 |
| Related human gene: | RPS6KA3 |
| Associated human disease: | Mental retardation, X-linked 19 |
| People involved in this project: |
|
| Left primer sequence: | ctcgatgccacacttcttga |
| Right primer sequence: | cacttgtgaaccaccgaatg |
| Size of PCR product: | 450 |
| Brief description: | rskn-1 is a member of a multigene family that includes growth factor-regulated serine/threonine kinases. The human homologue RPS6KA3 is involved in developmental processes including regulation of synapsis. |
| Report any problems that might have appeared and any solutions: | |
