| Worm gene name: | hypothetical gene |
| Worm sequence name: | C56C10.10 |
| Related human gene: | Aryl-hydrocarbon receptor-interacting protein |
| Associated human disease: | retinitis pigmentosa |
| People involved in this project: |
|
| Left primer sequence: | ccacgacctcttcgatttgt |
| Right primer sequence: | cttctgcctcgtccaacttc |
| Size of PCR product: | 424 |
| Brief description: | This gene is associated with the vertebrate retina. However, C. elegans does not appear to have an homologous sensory structure. |
| Report any problems that might have appeared and any solutions: | |
