Home | Projects | Login or register:
Username:   Password:

Worm gene name:  hypothetical gene
Worm sequence name:  C56C10.10
Related human gene:  Aryl-hydrocarbon receptor-interacting protein
Associated human disease:  retinitis pigmentosa
People involved in this project: 
Left primer sequence:  ccacgacctcttcgatttgt
Right primer sequence:  cttctgcctcgtccaacttc
Size of PCR product:  424
Brief description:  This gene is associated with the vertebrate retina. However, C. elegans does not appear to have an homologous sensory structure.
Report any problems that might have appeared and any solutions: 
View(0) or add comments