| Worm gene name: | WBGene00001442 |
| Worm sequence name: | C25A1.2 |
| Related human gene: | Fox03A |
| Associated human disease: | KO increases angiogenesis markers in vitro |
| People involved in this project: |
|
| Left primer sequence: | tgagcccaacagaatgtcaa |
| Right primer sequence: | ccatatgacggcgaactttt |
| Size of PCR product: | 330 |
| Brief description: | Forkhead transcription factors are associated with G2-M checkpoint regulations. In addition, higher levels of FOXO3A have been assoicated with increase longivity in human trials. We were interested in the effects of reducing the expression of this transcription factor in c elegans. Groups have looked at this with other RNAi primers and have observed abnormalities. A mutant strain also exists for this gene: RB884. |
| Report any problems that might have appeared and any solutions: | |
