Home | Projects | Login or register:
Username:   Password:

Worm gene name:  mek-2
Worm sequence name:  Y54E10BL.6
Related human gene:  ERK kinase, MEK kinase
Associated human disease: 
People involved in this project: 
Left primer sequence:  aacgactcacaggatcccac
Right primer sequence:  agacgtctgcggtgagagat
Size of PCR product:  363
Brief description:  efficiency 40.23 primer ranking 1
to silence single kinases that modify tyrosine hydroxylase to see how important phosphorylation is in vivo (C elegans does have a tyrosine hydroxylase: cat-2)
Report any problems that might have appeared and any solutions: 
View(0) or add comments