Worm gene name: | mek-2 |
Worm sequence name: | Y54E10BL.6 |
Related human gene: | ERK kinase, MEK kinase |
Associated human disease: | |
People involved in this project: |
|
Left primer sequence: | aacgactcacaggatcccac |
Right primer sequence: | agacgtctgcggtgagagat |
Size of PCR product: | 363 |
Brief description: | efficiency 40.23 primer ranking 1
to silence single kinases that modify tyrosine hydroxylase to see how important phosphorylation is in vivo (C elegans does have a tyrosine hydroxylase: cat-2) |
Report any problems that might have appeared and any solutions: | |