| Worm gene name: | let-23 |
| Worm sequence name: | ZK1067.1 |
| Related human gene: | EGF-R |
| Associated human disease: | Cancer |
| People involved in this project: |
|
| Left primer sequence: | cgcaatttatcaatgcgatg |
| Right primer sequence: | acgtcccaacacttttccag |
| Size of PCR product: | 363 |
| Brief description: | The EGF-R initiates many pathways within the cell including the Ras-Raf-MEK-ERK signaling system. Abnormal regulation of the pathway is known to alter cellular behavior and can result in cancerous growths. |
| Report any problems that might have appeared and any solutions: | |
