Home | Projects | Login or register:
Username:   Password:

Worm gene name:  let-23
Worm sequence name:  ZK1067.1
Related human gene:  EGF-R
Associated human disease:  Cancer
People involved in this project: 
Left primer sequence:  cgcaatttatcaatgcgatg
Right primer sequence:  acgtcccaacacttttccag
Size of PCR product:  363
Brief description:  The EGF-R initiates many pathways within the cell including the Ras-Raf-MEK-ERK signaling system. Abnormal regulation of the pathway is known to alter cellular behavior and can result in cancerous growths.
Report any problems that might have appeared and any solutions: 
View(0) or add comments