Home | Projects | Login or register:
Username:   Password:

Worm gene name:  F36H5.4
Worm sequence name:  F36H5.4
Related human gene:  dystrophin
Associated human disease:  DMD
People involved in this project: 
Left primer sequence:  tacattgcggaagtcaacca
Right primer sequence:  aaatgcaaagtgtgtgcagc
Size of PCR product:  523
Brief description:  muscular dystrophy is a genetic disease resulting from a deletion in group of genes associated with the production of normal muscle protein named dystrophin.
Report any problems that might have appeared and any solutions: 
View(0) or add comments