Worm gene name: | F36H5.4 |
Worm sequence name: | F36H5.4 |
Related human gene: | dystrophin |
Associated human disease: | DMD |
People involved in this project: |
|
Left primer sequence: | tacattgcggaagtcaacca |
Right primer sequence: | aaatgcaaagtgtgtgcagc |
Size of PCR product: | 523 |
Brief description: | muscular dystrophy is a genetic disease resulting from a deletion in group of genes associated with the production of normal muscle protein named dystrophin. |
Report any problems that might have appeared and any solutions: | |