| Worm gene name: | cmk-1 |
| Worm sequence name: | K07A9.2 |
| Related human gene: | calmodulin calcium dependent protein kinase |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | atattcacggaactgtcgcc |
| Right primer sequence: | ggggtactgtggctgaaaaa |
| Size of PCR product: | 549 |
| Brief description: | probe specificity 100.00 efficiency 29.11 primer ranking 1
to silence proteins that affect the activity of tyrosine hydroxylase TyrH. calmodulin-calcium kinase labels TyrH and activates it. the worm tyrosine hydroxylase does not have the same phosphorylation sites as the vertebrate enzyme, but it does have multiple phosphorylation sites. |
| Report any problems that might have appeared and any solutions: | |
