| Worm gene name: | pat-2 |
| Worm sequence name: | F54F2.1 |
| Related human gene: | integrin alpha subunit |
| Associated human disease: | skin cancer/psoriasis |
| People involved in this project: |
|
| Left primer sequence: | gctccagcttgttctccaac |
| Right primer sequence: | ggaaaatgatggccagaaga |
| Size of PCR product: | 435 |
| Brief description: | In C. elegans, pat-2 encodes alpha integrin subunit. This gene is essential for body wall assembly and function, hence proper development and hatching.
Integrins belong to a family of cell-extracelluar matrix adhesion molecules. It has been seen that some human basal cell carcinomas and other skin diseases reveal altered/upregulated integrin expression. Thus, integrins, (specifically alpha subunit components) and their receptors may participate in modulation of growth, development, and organization of human skin, and may present potential targets for anti-tumor therapy. |
| Report any problems that might have appeared and any solutions: | have not tried this yet |
