Worm gene name: | ftt-2 |
Worm sequence name: | F52D10.3 |
Related human gene: | 14-3-3 proteins: beta, delta, gamma, eta, zeta, tau, epsilon |
Associated human disease: | |
People involved in this project: |
|
Left primer sequence: | catctgccaagacgttctca |
Right primer sequence: | ccgaggtccagagagtcaag |
Size of PCR product: | 416 |
Brief description: | probe specificity 51.39 efficiency 17.93 primer ranking 1
in vertebrates there are 7 isoforms of 14-3-3 protein, so there mayl be several targets. my interest is in silencing proteins that modify tyrosine hydroxylase. 14-3-3 proteins are reported to bind to and activate tyrosine hydroxylase if TyrH is phosphorylated by CaMKII (C elegans does have a tyrosine hydroxylase: cat-2, does have a calmodulin kinase) |
Report any problems that might have appeared and any solutions: | |