Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ftt-2
Worm sequence name:  F52D10.3
Related human gene:  14-3-3 proteins: beta, delta, gamma, eta, zeta, tau, epsilon
Associated human disease: 
People involved in this project: 
Left primer sequence:  catctgccaagacgttctca
Right primer sequence:  ccgaggtccagagagtcaag
Size of PCR product:  416
Brief description:  probe specificity 51.39 efficiency 17.93 primer ranking 1
in vertebrates there are 7 isoforms of 14-3-3 protein, so there mayl be several targets. my interest is in silencing proteins that modify tyrosine hydroxylase. 14-3-3 proteins are reported to bind to and activate tyrosine hydroxylase if TyrH is phosphorylated by CaMKII (C elegans does have a tyrosine hydroxylase: cat-2, does have a calmodulin kinase)
Report any problems that might have appeared and any solutions: 
View(0) or add comments