| Worm gene name: | kin-2 |
| Worm sequence name: | R07E4.6 |
| Related human gene: | cAMP_dependent protein kinase |
| Associated human disease: | S Colette Daubner |
| People involved in this project: |
|
| Left primer sequence: | ccagcccaaaatcctagtca |
| Right primer sequence: | aatgctggataagggtgacg |
| Size of PCR product: | 429 |
| Brief description: | homolog of cAMP_dependent protein kinase
specificity 51.34 efficiency 7 primer set #2 to silence single kinases that modify tyrosine hydroxylase to see how important phosphorylation is in vivo (C elegans does have a tyrosine hydroxylase: cat-2) |
| Report any problems that might have appeared and any solutions: | |
