Home | Projects | Login or register:
Username:   Password:

Worm gene name:  kin-2
Worm sequence name:  R07E4.6
Related human gene:  cAMP_dependent protein kinase
Associated human disease:  S Colette Daubner
People involved in this project: 
Left primer sequence:  ccagcccaaaatcctagtca
Right primer sequence:  aatgctggataagggtgacg
Size of PCR product:  429
Brief description:  homolog of cAMP_dependent protein kinase
specificity 51.34 efficiency 7 primer set #2 to silence single kinases that modify tyrosine hydroxylase to see how important phosphorylation is in vivo (C elegans does have a tyrosine hydroxylase: cat-2)
Report any problems that might have appeared and any solutions: 
View(0) or add comments