Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Prdx-2
Worm sequence name:  F09E5.15a.1
Related human gene:  peroxiredoxin
Associated human disease:  increased sensitivity to sublethal doses of H2O2 and resistance to heavy metal
People involved in this project: 
Left primer sequence:  gaaagccagctccacaattc
Right primer sequence:  caaacctctccgtgcttctc
Size of PCR product:  554
Brief description:  explore the effect of silencing Prdx-2 on worms and its role in antioxidant defence against envionmental radiation.
Report any problems that might have appeared and any solutions:  none
View(0) or add comments