| Worm gene name: | apl-1 |
| Worm sequence name: | C42D8.8 |
| Related human gene: | APLP1 |
| Associated human disease: | Alzheimer disease |
| People involved in this project: |
|
| Left primer sequence: | gtgatgaaggagtggggaga |
| Right primer sequence: | cgatgaataacggttggctt |
| Size of PCR product: | 454 |
| Brief description: | This gene encodes an almost identical isoform orthologous to human APLP-1, the overexpression of which may cause abnormal locomotion, infertility, and partial lethality. |
| Report any problems that might have appeared and any solutions: | The above abnormalities may be observed in the worms due to the overexpressed APL-1, which hopefully can be inhibited by introducing RNAi feeding bacteria. |
