Home | Projects | Login or register:
Username:   Password:

Worm gene name:  apl-1
Worm sequence name:  C42D8.8
Related human gene:  APLP1
Associated human disease:  Alzheimer disease
People involved in this project: 
  • Xin Wen, California State University, Los Angeles, CA
Left primer sequence:  gtgatgaaggagtggggaga
Right primer sequence:  cgatgaataacggttggctt
Size of PCR product:  454
Brief description:  This gene encodes an almost identical isoform orthologous to human APLP-1, the overexpression of which may cause abnormal locomotion, infertility, and partial lethality.
Report any problems that might have appeared and any solutions:  The above abnormalities may be observed in the worms due to the overexpressed APL-1, which hopefully can be inhibited by introducing RNAi feeding bacteria.
View(0) or add comments