Home | Projects | Login or register:
Username:   Password:

Worm gene name:  C05H8.1a
Worm sequence name:  C05H8.1a
Related human gene:  Calcium/calmodulin dependent protein kinase kinase 2 protein iso
Associated human disease:  Association of polymorphisms in P2RX7 and CaMKKb with anxiety
People involved in this project: 
Left primer sequence:  tttttattcgggtcgagcac
Right primer sequence:  tcactctgacgcaattctcg
Size of PCR product:  400
Brief description:  Calcium/calmodulin dependent protein kinases play important role in calcium-mediated signal transduction pathway. One example of this is unc-43 in C. elegans. It interacts with mitogen activated protein kinase (MAPK) and many other calmodulin binding proteins. Calcium/calmodulin binding proteins (CKK-1) may have significant role in synaptic acitivities and neuromuscular pathways, in oocyte development and male fecundity.
Report any problems that might have appeared and any solutions: 
View(0) or add comments