| Worm gene name: | C05H8.1a |
| Worm sequence name: | C05H8.1a |
| Related human gene: | Calcium/calmodulin dependent protein kinase kinase 2 protein iso |
| Associated human disease: | Association of polymorphisms in P2RX7 and CaMKKb with anxiety |
| People involved in this project: |
|
| Left primer sequence: | tttttattcgggtcgagcac |
| Right primer sequence: | tcactctgacgcaattctcg |
| Size of PCR product: | 400 |
| Brief description: | Calcium/calmodulin dependent protein kinases play important role in calcium-mediated signal transduction pathway. One example of this is unc-43 in C. elegans. It interacts with mitogen activated protein kinase (MAPK) and many other calmodulin binding proteins. Calcium/calmodulin binding proteins (CKK-1) may have significant role in synaptic acitivities and neuromuscular pathways, in oocyte development and male fecundity. |
| Report any problems that might have appeared and any solutions: | |
