| Worm gene name: | gspd-1 |
| Worm sequence name: | GenBank: Z73102.1: Caenorhabditis elegans Cosmid B0035 |
| Related human gene: | G6PD |
| Associated human disease: | G6PD deficiency |
| People involved in this project: |
|
| Left primer sequence: | gggattcggtgttgaagaaa |
| Right primer sequence: | ctttggagcaacccatttgt |
| Size of PCR product: | 305 |
| Brief description: | G6PD deficiency is a common metabolic disease with multiple genetic lesions leading to a range of clinical manifestations from anemia to hemolytic attacks of RBCs under oxidative stress. |
| Report any problems that might have appeared and any solutions: | The PCR product size to be rechecked in Gene locus 23132..25488 on cosmid B0035 |
