Home | Projects | Login or register:
Username:   Password:

Worm gene name:  gspd-1
Worm sequence name:  GenBank: Z73102.1: Caenorhabditis elegans Cosmid B0035
Related human gene:  G6PD
Associated human disease:  G6PD deficiency
People involved in this project: 
Left primer sequence:  gggattcggtgttgaagaaa
Right primer sequence:  ctttggagcaacccatttgt
Size of PCR product:  305
Brief description:  G6PD deficiency is a common metabolic disease with multiple genetic lesions leading to a range of clinical manifestations from anemia to hemolytic attacks of RBCs under oxidative stress.
Report any problems that might have appeared and any solutions:  The PCR product size to be rechecked in Gene locus 23132..25488 on cosmid B0035
View(0) or add comments