Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Peroxisome Proliferator-Activated Receptor gamma
Worm sequence name:  F21D12.2
Related human gene:  Peroxisome Proliferator-Activated Receptor gamma
Associated human disease:  Obesity, Diabetes, Chronic Lung Disease, Metabolic Syndrome
People involved in this project: 
Left primer sequence:  tcatcgaaccgcttcttctt
Right primer sequence:  acacccgtcgaaaaattcag
Size of PCR product:  433
Brief description:  Key nuclear transcription factor that determines cell adipogenic differentiation and cell proiferation
Report any problems that might have appeared and any solutions: 
View(0) or add comments