| Worm gene name: | Peroxisome Proliferator-Activated Receptor gamma |
| Worm sequence name: | F21D12.2 |
| Related human gene: | Peroxisome Proliferator-Activated Receptor gamma |
| Associated human disease: | Obesity, Diabetes, Chronic Lung Disease, Metabolic Syndrome |
| People involved in this project: |
|
| Left primer sequence: | tcatcgaaccgcttcttctt |
| Right primer sequence: | acacccgtcgaaaaattcag |
| Size of PCR product: | 433 |
| Brief description: | Key nuclear transcription factor that determines cell adipogenic differentiation and cell proiferation |
| Report any problems that might have appeared and any solutions: | |
