| Worm gene name: | erm-1 |
| Worm sequence name: | C01G8.5 |
| Related human gene: | villin 2 (ezrin) |
| Associated human disease: | cancer |
| People involved in this project: |
|
| Left primer sequence: | ccgaaatatcgaaaaaccga |
| Right primer sequence: | gagagagaggggaaaagcgt |
| Size of PCR product: | 521 |
| Brief description: | The ezrin protein encoded by the human villin-2 gene plays a role in signal transduction, cell motility, migration and metastasis. Ezrin is overexpressed in many cancers including pancreatic cancer. It has been shown by others that overexpression of ezrin results in sequestration of E cadherin which results in decreased cell adhesion. To study how villin2 (ezrin) gene is involved in cell adhesion in a model organism, I searched for related genes in C. elegans by using BLAST and found that erm-1 was the related gene to Villin-2 in C elegans. I then designed primers to amplify the gene and ulimately transform into an RNAi feeding strain of E. coli so that they could be fed to the worms. |
| Report any problems that might have appeared and any solutions: | |
