Worm gene name: |
Leptin receptor gene-related protein
|
Worm sequence name: |
C30B5.2
|
Related human gene: |
Ob-RGRP
|
Associated human disease: |
Obesity
|
People involved in this project: |
|
Left primer sequence: |
acatggaccccaatgtttgt
|
Right primer sequence: |
actggctccagcttccact
|
Size of PCR product: |
381
|
Brief description: |
Obesity is a major epidemic disease today. Genetic studies in mice models have revealed the leptin signaling pathway as a regulator of body weight. Leptin binds to its receptor Ob-R, and causes a reduction in food intake, thereby controlling body weight. Obese individuals have been shown to have inactivating mutations in the Ob-R gene, leading to an inability to sense leptin levels. Recently, Ob-RGRP was discovered as a negative regulator of Ob-R and hence, its over-expression is likely to increase body weight. In worms, although there is no leptin protein, a homolog of the Ob-RGRP has been found. It is hypothesized that this may have a similar function for regulating body weight. Silencing of this gene will lead to interesting insights into the regulation of feeding in worms as well as control of body weight.
|
Report any problems that might have appeared and any solutions: |
|