Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Leptin receptor gene-related protein
Worm sequence name:  C30B5.2
Related human gene:  Ob-RGRP
Associated human disease:  Obesity
People involved in this project: 
  • Nitika Parmar, California State University, Channel islands, CA
Left primer sequence:  acatggaccccaatgtttgt
Right primer sequence:  actggctccagcttccact
Size of PCR product:  381
Brief description:  Obesity is a major epidemic disease today. Genetic studies in mice models have revealed the leptin signaling pathway as a regulator of body weight. Leptin binds to its receptor Ob-R, and causes a reduction in food intake, thereby controlling body weight. Obese individuals have been shown to have inactivating mutations in the Ob-R gene, leading to an inability to sense leptin levels. Recently, Ob-RGRP was discovered as a negative regulator of Ob-R and hence, its over-expression is likely to increase body weight. In worms, although there is no leptin protein, a homolog of the Ob-RGRP has been found. It is hypothesized that this may have a similar function for regulating body weight. Silencing of this gene will lead to interesting insights into the regulation of feeding in worms as well as control of body weight.
Report any problems that might have appeared and any solutions: 
View(0) or add comments