| Worm gene name: | Leptin receptor gene-related protein |
| Worm sequence name: | C30B5.2 |
| Related human gene: | Ob-RGRP |
| Associated human disease: | Obesity |
| People involved in this project: |
|
| Left primer sequence: | acatggaccccaatgtttgt |
| Right primer sequence: | actggctccagcttccact |
| Size of PCR product: | 381 |
| Brief description: | Obesity is a major epidemic disease today. Genetic studies in mice models have revealed the leptin signaling pathway as a regulator of body weight. Leptin binds to its receptor Ob-R, and causes a reduction in food intake, thereby controlling body weight. Obese individuals have been shown to have inactivating mutations in the Ob-R gene, leading to an inability to sense leptin levels. Recently, Ob-RGRP was discovered as a negative regulator of Ob-R and hence, its over-expression is likely to increase body weight. In worms, although there is no leptin protein, a homolog of the Ob-RGRP has been found. It is hypothesized that this may have a similar function for regulating body weight. Silencing of this gene will lead to interesting insights into the regulation of feeding in worms as well as control of body weight. |
| Report any problems that might have appeared and any solutions: | |
