Home | Projects | Login or register:
Username:   Password:

Worm gene name:  SIMILAR TO XERODEMA PIGMENTOSUM D
Worm sequence name:  Y50D7A.2
Related human gene:  XPD
Associated human disease:  Xeroderma pigmentosum complement D
People involved in this project: 
Left primer sequence:  gacttcccaaatcgcaaaaa
Right primer sequence:  gcaaaccggtaaataggcaa
Size of PCR product:  540
Brief description:  mutation leads to pre-natal developmental problems such as"larval arrest", "embryonic lethal", and post-natal problems such as "slow growth" and "sterile offspring";
RNA polymerase II transcription initiation/nucleotide excision repair factor TFIIH, 5'-3' helicase subunit
Report any problems that might have appeared and any solutions:  none
View(0) or add comments