| Worm gene name: | ptp-2 |
| Worm sequence name: | F59G1.5 |
| Related human gene: | PTPN11 |
| Associated human disease: | PTPN11 LEOPARD SYNDROME 1 LEOPARD is an acronym for the manifestations of this syndrome as listed by Gorlin et al. (1969): multi |
| People involved in this project: |
|
| Left primer sequence: | caattttcagcggctctctc |
| Right primer sequence: | ggccaatatctcgcacattt |
| Size of PCR product: | 375 |
| Brief description: | Explore the effects of silencing this gene in c.elegans. The human disease is characterized by multiple lentigines, electrocardiographic conduction abnormalities, ocular hypertelorism, pulmonic stenosis, abnormal genitalia, retardation of growth, and sensorineural deafness. |
| Report any problems that might have appeared and any solutions: | N/A |
