Worm gene name:  kpc-1
Worm sequence name:  F11A6.1
Related human gene:  Furin
Associated human disease: 
People involved in this project: 
Left primer sequence:  tcgaaaaggaaaaggctcaa
Right primer sequence:  gcatccatcaacccataacc
Size of PCR product:  450
Brief description:  Kex-2/furin like serine protease; other furin-like convertases are implicated in Notch and TGF-beta signaling pathways.
Report any problems that might have appeared and any solutions: