| Worm gene name: | kpc-1 |
| Worm sequence name: | F11A6.1 |
| Related human gene: | Furin |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | tcgaaaaggaaaaggctcaa |
| Right primer sequence: | gcatccatcaacccataacc |
| Size of PCR product: | 450 |
| Brief description: | Kex-2/furin like serine protease; other furin-like convertases are implicated in Notch and TGF-beta signaling pathways. |
| Report any problems that might have appeared and any solutions: | |
