| Worm gene name: | C46E1.3 |
| Worm sequence name: | C46E1.3 |
| Related human gene: | none |
| Associated human disease: | none |
| People involved in this project: |
|
| Left primer sequence: | tggtcagtggaactgttgga |
| Right primer sequence: | aatttcgtggcagataacgg |
| Size of PCR product: | 527 |
| Brief description: | unknown gene with no known human homolog and known C. elegans RNAi or mutant phenotype |
| Report any problems that might have appeared and any solutions: | |
