Home | Projects | Login or register:
Username:   Password:

Worm gene name:  C46E1.3
Worm sequence name:  C46E1.3
Related human gene:  none
Associated human disease:  none
People involved in this project: 
  • Ray Hong, California State University, Northridge, CA
Left primer sequence:  tggtcagtggaactgttgga
Right primer sequence:  aatttcgtggcagataacgg
Size of PCR product:  527
Brief description:  unknown gene with no known human homolog and known C. elegans RNAi or mutant phenotype
Report any problems that might have appeared and any solutions: 
View(0) or add comments