| Worm gene name: | ptl-1 |
| Worm sequence name: | F42G9.9 |
| Related human gene: | tau/MAP2/MAP4 |
| Associated human disease: | Picks Disease/ Alzheimers |
| People involved in this project: |
|
| Left primer sequence: | gctggtggaaatgttcaggt |
| Right primer sequence: | aagcgtggtccgatcataac |
| Size of PCR product: | 330 |
| Brief description: | microtubule binding protein homologous to tau/MAP2/MAP4 associated with neurodegenerative disorders including Alzheimers and Picks Disease |
| Report any problems that might have appeared and any solutions: | |
