Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ptl-1
Worm sequence name:  F42G9.9
Related human gene:  tau/MAP2/MAP4
Associated human disease:  Picks Disease/ Alzheimers
People involved in this project: 
Left primer sequence:  gctggtggaaatgttcaggt
Right primer sequence:  aagcgtggtccgatcataac
Size of PCR product:  330
Brief description:  microtubule binding protein homologous to tau/MAP2/MAP4 associated with neurodegenerative disorders including Alzheimers and Picks Disease
Report any problems that might have appeared and any solutions: 
View(0) or add comments