| Worm gene name: | stn-2 |
| Worm sequence name: | F27D9.8 |
| Related human gene: | syntrophin |
| Associated human disease: | not known |
| People involved in this project: |
|
| Left primer sequence: | tccgttacgaaatcacacca |
| Right primer sequence: | ggctggcaatcctttgaata |
| Size of PCR product: | 306 |
| Brief description: | Iin C. elegans, this protein is associated with neurons and muscles, and is known to cause abnormal locomotion and head movements |
| Report any problems that might have appeared and any solutions: | |
