Home | Projects | Login or register:
Username:   Password:

Worm gene name:  clh-3
Worm sequence name:  E04F6.11
Related human gene:  CLC-2
Associated human disease:  myotonia epilepsy
People involved in this project: 
Left primer sequence:  ggggaagatgatgctcaaaa
Right primer sequence:  tcatttgctgatcttgctcg
Size of PCR product:  346
Brief description:  The worm gene clh-1 codes for a chloride channel. It is homologous to the human channel CLC-2. The CLC class of chloride channels/transporters are found in many types of cells usually regulating voltage or ion concentrations. Mutations of the CLC-2 gene are associated with myotonia and some epilepsies
Report any problems that might have appeared and any solutions: 
View(0) or add comments