| Worm gene name: | clh-3 |
| Worm sequence name: | E04F6.11 |
| Related human gene: | CLC-2 |
| Associated human disease: | myotonia epilepsy |
| People involved in this project: |
|
| Left primer sequence: | ggggaagatgatgctcaaaa |
| Right primer sequence: | tcatttgctgatcttgctcg |
| Size of PCR product: | 346 |
| Brief description: | The worm gene clh-1 codes for a chloride channel. It is homologous to the human channel CLC-2. The CLC class of chloride channels/transporters are found in many types of cells usually regulating voltage or ion concentrations. Mutations of the CLC-2 gene are associated with myotonia and some epilepsies |
| Report any problems that might have appeared and any solutions: | |
