| Worm gene name: | Transketolase |
| Worm sequence name: | Y39E4A.3 |
| Related human gene: | BCKDHA |
| Associated human disease: | Maple Syrup Urine Disease |
| People involved in this project: |
|
| Left primer sequence: | cgtacgctttcaagcaacaa |
| Right primer sequence: | aaactgcaaattcttgcgct |
| Size of PCR product: | 310 |
| Brief description: | Maple syrup urine disease (MSUD) is an autosomal recessive disorder that is most prevalent among some Mennonite populations. There are several causes all of which affect the processing of selected amino acids (ex. leucine, isoleucine, valine). The most common form of the disease is diagnosed shortly after birth. Affected children often have digestive problems and excrete a sweet smelling urine. Four genes have been identified as causes of this disorder. One of those genes, BCKDHA, was studied in this project. |
| Report any problems that might have appeared and any solutions: | Creating an RNAi Feeding strain experiment results: Initially used Primer #1. Did not work. Continued using Prime #7 (from Coe). Results obtained with pGEMt vector. No results obtained with L4440 vector |
